Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST391157
Clone ID OST391157
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST391157
Sequence
GACTGAGGTTAAAAGCTGCTTTGCATGTGCCCAGTAGATTTTCATGGAATCTTCCAACTAGATGAAAGACGGAGAGATGC
AGTGATTGCATTGGGCATTTTTCTCATTGAATCTGATCTTCAGCACAAAGATTGTGTTGTTCCTTATCTTCTTCGACTTC
TCAGGGGTCTTCCAAAAGTGTATTGGGTAGAAGAAAGCACAGCTCGGAAAGGCAGAGGTAACCTCCCAGTTGCAGAGAGC
TTCAGCTTCTGCCTGGTGACCTTGCTGTCTGATGTGGCTTGCAGGGACCCCTCACTTAGGGATGAGATTTTAGAGGCAAT
TTTGCAGGTTTTACATGTCCTTTTGGGAATGTGCCAGGCCTTGGAGATTCAAGAAAAAGAATACCTTTGCAAGTATGCGA
TCCCATGCCTGATAGGAATCTCAAGATCTTTTGGACGTTACAGCAATTCAGAAGAGTCTCTCCTCTCAAAGCTTTTCCCC
AAAGTTTCTCCTCATTCCCTGAGAATCCCAGAAGAGCTAGAAGGTGTCCGAAGGCGTTCCTTT
Sequence Type mRNA
Unitrap ID UNI19437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17377107..17389552 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041720 (Pi4ka) NM_001001983 phosphatidylinositol 4-kinase, catalytic, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:2448506]

 
Come back to gene ENSMUSG00000041720


For any suggestions or comments, please send an email to unitrap@crg.es