Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0712
Clone ID AC0712
Vector pGT0lxr
Project sanger

Sequence tag AC0712
Sequence
GGCGGCGGTGGCAGTTCGCAGCGAGGGCGACGGCTCCGAGGCCGAGAGGCAGTCCAGCGAGGACCTGGGCGCCGTCCTCC
GCATGACCTCACCG
Sequence Type mRNA
Unitrap ID UNI3687

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34609786..34609879 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026867 (Gapvd1) NM_025709 GTPase activating protein and VPS9 domains 1 Gene [Source:MGI (curated);Acc:Gapvd1-001]

 
Come back to gene ENSMUSG00000026867


For any suggestions or comments, please send an email to unitrap@crg.es