Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST390652
Clone ID OST390652
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST390652
Sequence
ATTGACCGCCAGTATNACCACGANGAACGAACACTTGTACGGACGTGGGAGGAAATTGTCAGCGTCCNNGGCTTCANNCT
GGAGGNNANGCTACNTAGCCAGNTATACCAGGGGGACTTCGTGCATGCTATGGAAGGCAAAGATTTTAACTATGAGTACG
TACAGANAGAANCTCTCAGGGTCCCCCTGGTTTTTCANGNACAAGGATGGACTAGGGATCAAGATGCCAGACCCTGATTT
CACAGTCCGAGACGTCAAACTCCTGGTGGGGAGCCGCCGTTTGGTGGATGTCATGGACGTCAACACCCAGAAGGGTACCG
AGATGAGCATGTCCCAGTTTGTGCGCTACTACGAAAGAGCAACAAATAAATAATGACCTTGAATCTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19470

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122873973..123437809 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es