Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST390613
Clone ID OST390613
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST390613
Sequence
AACAGACTTCTGCCTGGCTCGGTGGAGAAGTATTGTCTGGAACCCCAAACTGAGGCCGACTGCATCGACAACATCAATGA
CTTCCTGAAAGGACCT
Sequence Type mRNA
Unitrap ID UNI19473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 54590150..54591544 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031133 (Arhgef6) NM_152801 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI (curated);Acc:Arhgef6-001]

 
Come back to gene ENSMUSG00000031133


For any suggestions or comments, please send an email to unitrap@crg.es