Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST390298
Clone ID OST390298
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST390298
Sequence
GTGGAACTCTCGAGGCCCTCTAGAGCAGCANGAGAAGAAAGCATAGACCATTGGAGAAAAACGGCCAAGAGGCAGACCTA
GGAAATGGCCACAACAAGTCGTTCAGAAGAAGCCTGCTCAGGTAAGAGACGCCCCCTTGTGATTATTCTCAAGAAAAAAA
A
Sequence Type mRNA
Unitrap ID UNI19491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119811684..119899772 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056758 (Hmga2) NM_010441 high mobility group AT-hook 2 Gene [Source:MGI Symbol;Acc:MGI:101761]

 
Come back to gene ENSMUSG00000056758


For any suggestions or comments, please send an email to unitrap@crg.es