Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST390215
Clone ID OST390215
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST390215
Sequence
TTTCCTGGATTCATCACCAAGGNNTGNACCTGGAATGGCGGCAGTAACTATCAGGCAAACCGACAGACTTCTAACTACAA
TTCAGCCAAAATGTCTACTCCAATTGACAAGTCCTTGCGAAAATTTGAAAATAAAATCAATCTAAATAA
Sequence Type mRNA
Unitrap ID UNI7976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 38132094..38135014 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021428 (Riok1) NM_024242 RIO kinase 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918590]

 
Come back to gene ENSMUSG00000021428


For any suggestions or comments, please send an email to unitrap@crg.es