Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST390176
Clone ID OST390176
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST390176
Sequence
GACTGAGGGGCCTTCGAGATTGAGATCAATGGACAGCTGGTGTTCTCCAAGCTGGAGAATGGAGGGTTTCCTTATGAGAA
AGACCTCATGGAAGCCATCCGAAGAGCCAGCAATGGAGAACCTGTAGAAAAGATCACCAACAGCCGGCCTCCCTGTGTCA
TCCTGTGACTAAGAAATGATTCTTGGAAGCTTGGTTCTGGGGTTTAAACCTTTCCTTGTGGTTACGCTAGGAATCCCTCT
ACCTTTAGCCCCTCACTTGGCCCTAGGTAACTAAGACCCTGACTTCACTTTGCCTCTTAGGGCACAAGGAGGGACTAGAC
ATTTCTGTGGCCAAAGGCAGAAAAGAGATGTTCTCTGTGAACATCACCATCGCTCTCCCGGGATCTGTGCCCTCTGCAGT
TTGGTCCTCTCCCCAGCGTGGCAATACCTTTCAGATGCCACGGTTGCTATAACTTATTTTCCCTGAATCCTGGGCAGTGT
CGGCTCTTGGCAATAAAGAG
Sequence Type mRNA
Unitrap ID UNI19497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98299044..98299629 416
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002580 (1810046J19Rik) NM_025559 RIKEN cDNA 1810046J19 gene Gene [Source:MGI Symbol;Acc:MGI:1913678]

 
Come back to gene ENSMUSG00000002580


For any suggestions or comments, please send an email to unitrap@crg.es