Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST390124
Clone ID OST390124
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST390124
Sequence
GACTGAGATATCTCCAGTACTCCAGNAGCCTTGTTCCTCATCTCCATCCTCTTCATGCTTATCAGCCTTGGCTTGCTCTT
GAGCTCTTGCCGCCCTGCAGAAAGAATGATGTCCGCTGAGTTGGATCTGAAGGTGTCCATGCTCAGCTTCTGCTCAGCTG
TCAGCTTGCTCCTCTGCCTCAACCTGTTTCTGGCGCAGGTTGAATTATACACAAAGAATGCCATGGAGTATGAGTTCCTG
TGGACCTACTATCTTAGTTGGTGCAGTGAGGTCTTATATATCTGTGTTGGGATCATCTCTTTTCTCAACTTCATAACTTT
CCAATTCCATCCTCCTGATGAGGGTGTCAGCGCGGATCTATGGCAGAAGTCCAGGCTGGGCATTGGGCCAGTGCCAAAAA
CACTGTCTGCTACAGCTGAAAGGTCACGTTCTGAGATGCAGTTTCTAAGTGGGAGACAGGAAAAACTACAGAATGTGAGA
AAGGGAAAACTGGCTACCACAAGACTGTGATAGGATGAC
Sequence Type mRNA
Unitrap ID UNI16257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59366852..60347105 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049526 (Tmem202) NM_178388 transmembrane protein 202 Gene [Source:MGI Symbol;Acc:MGI:1921143]

 
Come back to gene ENSMUSG00000049526


For any suggestions or comments, please send an email to unitrap@crg.es