Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389965
Clone ID OST389965
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389965
Sequence
GTGAAGGGCCGGGCGACCTGAATCCTAGTGCGGACAGCTCCCTGAAGTCACCGTGAAGCTTTTGTGGAAATGACAGGGAG
AATCAGAGTTGCCACCCAGAAAGGACAGGCTGGGCTCTGTCCCGCTGAGGGCCAGAACACGGACGTGAAGGAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI19507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116298311..116298463 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033439 (Ccdc76) NM_030016 coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]

 
Come back to gene ENSMUSG00000033439


For any suggestions or comments, please send an email to unitrap@crg.es