Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389963
Clone ID OST389963
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389963
Sequence
GACTGAGGAATCTGTGGGCTCCTGTGGCCGACACACATGAGGGTCATATCACCAGCGATATGCAGCTTTCTACCTACTTA
GACCCTGCCCTGGAGCTGGGTCCCCGTAATGTACTGCTGTTCCTACAGGACAAGCTAAGCATTGAGGATTTCACAGCATA
CTGGNGGNGTGNNTGGAAANANNCAGGACAGTGCNANTTTCTAACCTGNAGAATGCCCTGGACTTGGCCCCCTNCTCACT
GGNGCTTCCTGCTGTGGANTGGTATGNAATAAGNACTCTGANCACCTACCTACANGANAAGCTTGGGGCTAGCCCCTTGC
ATGTGGATCTAGGTACCTTANAGGANCTGAAGCTCAANGCCAGCCTTCCTGCCCTGCTGCTCATCCGTCTGCCCTACACA
GNCAGNTCCGGNCTGATGGCGCCCAGGGAGGNCCTCACAGGTNACGATGAGGGCATCGGACAGGCACTGANCACACTCAT
GTATGAA
Sequence Type mRNA
Unitrap ID UNI19508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71542960..71547315 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019087 (Atp6ap1) NM_018794 ATPase, H+ transporting, lysosomal accessory protein 1 Gene [Source:MGI (curated);Acc:Atp6ap1-001]

 
Come back to gene ENSMUSG00000019087


For any suggestions or comments, please send an email to unitrap@crg.es