Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389935
Clone ID OST389935
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389935
Sequence
GAAAACAGGCACTTATATGGCACCCGGACAAAAATCCTGAAAATAAAGAAGAAGCAGAGCGGAAGTTCAAACAAGTAGCT
GAGGCATATGAAGTGTTATCGGATGCTAAAAAGCGGGACATCTACGACAAATATGGCAAAGAAGGATTAAATGGTGGTGG
AGGAGGAGGTGGAATTCATTTTGACAGTCCATTTGAGTTTGGCTTCACATTCCGGAACCCAGATGATGTCTTCAGGGAAT
TTTTTGGTGGAAGGGACCCATTTTCATTTGACTT
Sequence Type mRNA
Unitrap ID UNI1344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30077483..30080187 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es