Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0676
Clone ID AE0676
Vector pGT0lxr
Project sanger

Sequence tag AE0676
Sequence
TTGTCCTGATTACAGATGGATCAGTACTAAAACCCGATTCTGATCAACAGGTCTCCATTTTGACAGTGCCAGCAGAAGAG
TCAGGAAGTTNTGCTGTTCGAGTCAGTGAGTTATGCTCTTCAACAATGACATGCATGAAATGGCACATACTTGGTACATT
TGACTTGCATGTCTTCTAAAACAGCAAGAGAAGATTTAGAACGAGTAGTCCAGAAATTGTTTACTCCATATACAGAAATC
GAAGCAGAAAATGAACAGGTTGAAAAGCCAAGAATTCTATGGGCACTCTACTTCAATATGAGAGACTCTTCGGATATCAG
CAGAGATTGTTATAATGATTTGCCGTCCAATGTCTAAGGTGCTCTGGCCTTGACTATCCTCTGCCCTTTCTCCTCCATGA
CCACCAGGT
Sequence Type mRNA
Unitrap ID UNI3695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 110160970..110183235 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025531 (Chm) NM_018818 choroidermia Gene [Source:MGI (curated);Acc:Chm-001]

 
Come back to gene ENSMUSG00000025531


For any suggestions or comments, please send an email to unitrap@crg.es