Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389895
Clone ID OST389895
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389895
Sequence
GACTGAGGAGGGAGCTATGGATTTGCTGCGGGAGCTGAAGAATATGCCTATTACATTGCACTTGCTCCAGNCCACCCGTG
TTGGGATGNCTGNCAATGCTCTGCGCAAGCAGAGTTCAGATGAGGAGCTCATTGCACTTGCCAAGTCCCTCATCAAGTCC
TGGAAGAAGCTCTTGGATGTTTCTGATGGCAAATCCAGGAATCAAGGGAGGGGCACACCTTTGCCTACATCATCATCAAA
GGATGCCTCAAGGACTACGGATCTCAGCTGCAAGAAGCCAGATCCACCTAGGACCCCATCCACTCCAAGGATCACTACAT
TTCCCCAAGTGCCCATCACCTGTGATGCTGTACGAAACAAATGCCGAGAGATGCTGACTTTGGCCCTGCAAACTGACCAC
GACCACGTGGCCGTTGGTGTGAACTGTGAGCATCTGTCATCTCAGATCGAGGAGTGCATCTTCCTGGACGTGGGAAATAC
TGACATGAAGTACAAGAATCGGGTGCGGAGCCGAATCTCTAACCTGAAAGATGCCAAGAACCCTGGGTC
Sequence Type mRNA
Unitrap ID UNI19512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181417916..181421393 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059540 (Tcea2) NM_009326 transcription elongation factor A (SII), 2 Gene [Source:MGI (curated);Acc:Tcea2-001]

 
Come back to gene ENSMUSG00000059540


For any suggestions or comments, please send an email to unitrap@crg.es