Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389890
Clone ID OST389890
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389890
Sequence
AAACGTGGACCAAGCTTTCCCTCTCCCACTGGAGGAAGGAGCTTGAAGCAGCAGCGGGACTGCTGGGGGAAGAAACCTCC
TTTTGATAAGTCTGAGTCAGTCAGTTGTCCTGGCCCCTGGGACCTGCTGGTGGTGATCCTAATCACGTGTGGTTGGTGCC
CACATGTATCCTTAGCTACTCTCAATAAATTTTTAAATGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108011162..108011325 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048997 (Atxn7l2) NM_175183 ataxin 7-like 2 Gene [Source:MGI (curated);Acc:Atxn7l2-001]

 
Come back to gene ENSMUSG00000048997


For any suggestions or comments, please send an email to unitrap@crg.es