Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389813
Clone ID OST389813
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389813
Sequence
GACTGAGGCATCACGTTTNAAACTGGAAAGGAAAAAACGGCCCACAGCAGCCTGTCACTCTTCAGAGGCGACACGGGTGT
CAAATATGGCTTGNTGGGACTGGAACCCACCAAGGTGGCCCTGAATTTGGAGCGGCTTNCGNNAGTGGNCAGTNGTGCTC
GGAGACACCACAGTCACCAGTGGCAGACACTACTGGGAGGTAACAGTGAAGCTGCGTCCCAGCAGTTCCGGATAGGAGTG
GCANACGTGNACATGTCCCGGNACAGCTGCTGTTGGTGCTTGATGATCGTTCCTGGGTGTTCTCCTATGCCCAGCGCAAG
TGGCACAGCATGTTGGCCAACNAAAAAGCTCCAATTAAGGGTATTGGGCAACCAGAGAAGGTGGGGCTGCTGCTGGACTA
TGAGGCAAANAAGCTGAGCCTGGTGGATGTGAGTCGGATCTCTGTGATCCACACACTACAGACAGATTTCCGGGGCCCAG
TGGCACCTGCTTTTGCTCTTTGGGATGGAGAGCTGCTAACCCACTCAGGACTCGAAGTGCCCAAGGGCCTCTAATGTGGC
CAA
Sequence Type mRNA
Unitrap ID UNI19515

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127647900..127648452 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051346 (Spryd4) NM_025716 SPRY domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913951]

 
Come back to gene ENSMUSG00000051346


For any suggestions or comments, please send an email to unitrap@crg.es