Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0547
Clone ID XT0547
Vector pGT0lxf
Project sanger

Sequence tag XT0547
Sequence
ACACAGAATTACCACGAGGAGATCATTATAAACCCGCAATCTCCCACCGAGATTTAAACAGCAGGAATGTCCTGGTAAAG
AATGACGGCGCGTGTGTTATCAGTGACTTTTGTTTATCCATGAGGCTTATTGGAATTTGGCTGGTGCGCCCAGGGGAAGA
AGATAATGCGGCTATAAGTGAGGTTGGCACAATTCGCTATATGGCACCAGAAGTGCTAGAAGGAGCTGTGAACGTGAGGG
ACTGTGAGTCAGCTCTGAAGTCAAGTGGACATTGTATGAAGCTTGGACTGCATCATACCTGTGGAGGCTGCTTTTGGAGG
TGTACAGACCTCCTCCCAGGTGAATCGGTACCAGATTACCAGATGGCTTTTCAGACAGAAGTGTGAACCATGCCACATTT
GAGGATATGCAGGTTCTTATGTCCAGAGAGAAGCAGATACCCAAGTTTCCAGAAGCCGGGAAAGAAAATAGCCTGGTTCC
AGGTC
Sequence Type mRNA
Unitrap ID UNI3697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59903996..59916155 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067336 (Bmpr2) NM_007561 bone morphogenic protein receptor, type II (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI:1095407]

 
Come back to gene ENSMUSG00000067336


For any suggestions or comments, please send an email to unitrap@crg.es