Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0522
Clone ID XT0522
Vector pGT0lxf
Project sanger

Sequence tag XT0522
Sequence
AGCTCTTCTAGATGGTGGTTTTGAGCTTTTCANGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAG
ATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGT
GAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTA
GATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTG
TGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCT
AGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTTTTTCAGACAGAAGTTGGAAACCATCC
CACATTTGAGGATATGCAGGTTCTTGTGTCCAGAGAGAAGCAGAGACCCAAGTTCCCAGAAGCCTGGAAAGAAAATAGCC
TG
Sequence Type mRNA
Unitrap ID UNI3699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59695969..59916153 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067336 (Bmpr2) NM_007561 bone morphogenic protein receptor, type II (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI:1095407]

 
Come back to gene ENSMUSG00000067336


For any suggestions or comments, please send an email to unitrap@crg.es