Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0521
Clone ID XT0521
Vector pGT0lxf
Project sanger

Sequence tag XT0521
Sequence
TTTCATGCTCTTTTTTTNTGCTCTTTAATTTCTCTTCCTGTTTTATTATTNGTCTGTTTTTCTTATTTCTGCCTCAACAA
TTCATCGTTCCCCTCCCGTTCCTCTTCGAGATCCTGGATCAGAAATTGAAGACAGACAGTACCAGATAGACCTGCAGTCC
ATCAANATCGGCACTGCTCAGTGGGATCAACTCAAACCAGAGAAAGGCAGTGGCTCAGGAGGAGTGCCAACAGAGAGTGA
GAGGAACTCTCAAAACCCAGCCCTGGAGTGGAACATGGCCAGCAGCATACAGNGGTATCAAGAAAGGAGAGCAATTTTGA
CACCCATCTTGACAGATTTTTTCTGTGCGAATAACTGGAGCACCTGCCATCATTTTCACCAAAATAATCTCCCAAGAAAA
TCTGCATATGGAG
Sequence Type mRNA
Unitrap ID UNI3704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35598477..35601180 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037646 (Vps13b) vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]

 
Come back to gene ENSMUSG00000037646


For any suggestions or comments, please send an email to unitrap@crg.es