Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389304
Clone ID OST389304
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389304
Sequence
TTTGAGGCAACCATCGGGATTGANTTTCTTGTCAAAAACCATGTACTTGGAAGACCGTACGGTTCGACTGCATNTCTGGG
ACACTGCTGGGCAAGAGAGGTTCCGCAGCCTGATCCCCAGCTACATCCGAGACTCCACGGTGGCTGTGGTGGTATATGAC
ATTACTAATCTCAACTCCTTCCAGCAGACTTCTAAATGGATTGATGACGTCAGGACGGAGAGGGGCAGTGACGTGATCAT
CATGCTTGTGGGTAACAAGACGGATCTGGCTGATAAGAGGCAGATAACCATCGAGGAAGGAGAACAGCGGGCCAAAGAAC
TGAGCGTCATGTTCATCGAGACCAGCGCGAAGACTGGCTACAACGTGAAGCAGCTCTTCCGACGTGTGGCGTCAGCTCTG
CCCGGCATGGAGAATGTCCAGGAGAAGAGCAAAGAAGGGATGATTGACATCAAGCTGGACAAGCCTCAGGAGCCCCCGGC
CAGCGAGGGCGGNTGCTCCTGTTAATGCACCGCCCACTCGGCTTNCTCAGCGCCACTCACAGTGCATGGAGGACACCC
Sequence Type mRNA
Unitrap ID UNI19539

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103063393..103083611 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032549 (Rab6b) NM_173781 RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]

 
Come back to gene ENSMUSG00000032549


For any suggestions or comments, please send an email to unitrap@crg.es