Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST389073
Clone ID OST389073
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST389073
Sequence
TGTCCTGGCCATCATCCGTACCCATTCCCAAGTCCCATGAGGCGGAGGCAGAACAGGCTGAGCCCAGAAGTGCAGAGGGG
CCAAAGAAGCCCAAGGTTGCCATCGCTTCCACCAACAAGAGGCCGAAGAAGGAGACGAAGAAGAAGCGATAGAATCCTAG
AATCCGAGGCCGAGGAGCCCAAGGCTGCAGCCTCGGGGACAGCCCTCCTGGGAACCAGCATCCTGTTTGCTCTCACAGAC
TGTCTCTGTCCTCGGCTCAGAGTCTGAGAGGATTGAAACTCCCTCTGACTACAGAGCTCTGAACAGTCCTTAGGCTCCAG
CTGTGCANACCACCACTTCCTCTTCTTTCTCTCTGTGGTGCACGGGAGATTCTCAAGAGCAAACATTAAAT
Sequence Type mRNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157204948..157221986 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es