Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0967
Clone ID GC0967
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC0967
Sequence
TTTGTTGACTGGCTTTTCATCCTTGTCATAGGGCCGCACAAACCACTTCCCGATCCGCACGAAGTTCTTATCCATTAGGC
ACCTTTCTAACAGATTGTGGATTGCTTTGAAGAGCAGCGTCCTACATTCATAGGAAAGGCCATTTTCCCAGAGTCCTTCT
TCCACAACCTGCAGTTCATGATGTATTACTCCCACTAGGTTGGGTTCATCTCCCCACCACAATATCCAGAGCTGTTTGCA
Sequence Type mRNA
Unitrap ID UNI357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 119043507..119130978 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018076 (Med13l) NP_766012 mediator complex subunit 13-like Gene [Source:MGI Symbol;Acc:MGI:2670178]

 
Come back to gene ENSMUSG00000018076


For any suggestions or comments, please send an email to unitrap@crg.es