Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST388801
Clone ID OST388801
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST388801
Sequence
GACTGAGAGACCCTTCCCAAGCACCACCGCCATCCTCTGCCATGGAGCTGGAAGAGAAGTCTGGTGCACCAGGTGACAAA
GAGGCACAGGTGTTCCCTCCTGCTAACGCCCTACCAGCCAGGAGTGAGGCAGCCGAGGTGCAGCCAGTGATCGGGATCAG
TCAGCTTGTGAGGATGAACTCCAAGGAAAAAAAAGACCTAGGAACTCTGGGCTACGTGCTGGGCATTACTATGATGGTGA
TCATCCTCGCTATTGGAGCTGGCATTATCGTGGGCTACACTTACAAGAGGGGGAAGGACTTNAANGANCAACATGAGAAG
AAAGCGNGTGAGAGGGANATGCANCGAATNACCTTGCCCCTGTNTGCCTTNACAAACCCNACCTGTGNGACCGTGGATGA
AAACACCATCNTTGTGCACAGCAACCANACTCCTGCTGACGTGCAGGAGGGCAGNACCCTCCTNACGGGCCAGGCTGGCA
CCCCTGGGGCCTGAGCCCCTTCAGTGGGCAGGTGCCCATGTAAACACTGGTACAGGACAGGCCACCCTCCTGCA
Sequence Type mRNA
Unitrap ID UNI14188

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3233210..3241790 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034614 (Pik3ip1) NM_178149 phosphoinositide-3-kinase interacting protein 1 Gene [Source:MGI (curated);Acc:Pik3ip1-001]

 
Come back to gene ENSMUSG00000034614


For any suggestions or comments, please send an email to unitrap@crg.es