Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST388542
Clone ID OST388542
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST388542
Sequence
TACTGAAGCTTGGCTGGGCAGTCTCTTATTCCTTGCTACCATGGTGATAGCATCCAAAGCAGTATGTTCTATTGAAAATC
GTGAGATATTTCCAAATCAAATGTCTGATGACTGCATGGATGCTGATGGTAACAAGCATTTCCTTAACACTCCCTGGAAG
AAGAACTGCACGTGGTGTTCATGTGACAAAACGTCAATCACCTGCTGTACCAACGCTACTAGGCCTTTGAGCTATGACAA
AGACAACTGTGATGTACAATTCCACCCAGAGAACTGCACCTACAGTGTGGTGGATCGGAAGAACCCAGGGAAGACCTGTC
GAGTTGACAGCTGGACTATGTAAATGTGCTTCGTGTGGGCCCAAAAGTGGAGTAACATTTGAACCTTGTATGATTTAAAT
TTACCAATCATAAGCTTGCAAGGAGGTGACCTGTAATCCCAGCACTCAGAAGGCAGAGGCAGCATATCTTGAAAAACTCA
AATAAATAAAAA
Sequence Type mRNA
Unitrap ID UNI17444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32961262..32971531 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021907 (Msmb) NM_020597 beta-microseminoprotein Gene [Source:MGI (curated);Acc:Msmb-001]

 
Come back to gene ENSMUSG00000021907


For any suggestions or comments, please send an email to unitrap@crg.es