Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST388295
Clone ID OST388295
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST388295
Sequence
GAACTGAGGAGGGAGCCTCACAGGNAGCATTGTTTAACCCAGCGCTGGCACTTTCTCTGCACTTTCCGTGCTTTGACGAA
CTCTTCTATAAGTTTTTTGTAGTATACTGGCTTGCTCCTTCTGTAGGTGTGCTGATGATGATCCTCATGTTCAGTTTTTT
CCTTCCATGGCTGCATAACAACCAAATGACTAATAAAAAAGAGTAACCACTCCCAAAGACTCGAACTAAGTCCCAGGACA
GTCAAGCTGGATGCGACAATCTGAGCACCCTCCAAACTCTGGACGCCTCCTGCTTCAGCTTTCTCTGTGGAAGGTGTCTT
AAGTTTTTACTACCTGGACTTCAAATTACTGTGAAAATGAGGTAGCCTGTATTTCTCAAGTTAAGACTTGTTCTCGAGTG
ATGTATTAAATGCTGCTAGAAAAGGCTCATTCATTAAACATCTACCTATCCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104874887..104877599 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042797 (Aqp11) NM_175105 aquaporin 11 Gene [Source:MGI Symbol;Acc:MGI:1913583]

 
Come back to gene ENSMUSG00000042797


For any suggestions or comments, please send an email to unitrap@crg.es