Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST386421
Clone ID OST386421
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST386421
Sequence
CCGACAGTTATTTATGCAAAACAGCTGAAAGAGAGATTGGAGGCTTTTACAAGAGATTTTCTTCCTCACATGAAAGAGGA
AGAAGAGGTTTTTCAGCCCATGTTAATGGAATATTTTACCTACGAGGAGCTTAAAGATATCAAAAAGAAAGTGATTGCAC
AGCACATGCTCACAGAAGGACACGGCAGAGCTCCTCAGAGGGCTCAGTCTGTGGAACCAAGCTGAGGAGCGACAGAAAGT
TCTCAAGTACTCTGTGGATGANAAGGCAGATACAGAAGCGGAAGTGTCAGAACACTCCACAGGTATAACCCATCTTNCTC
CTGAGGTAATGCTGTCCATTTTCAGTTACCTTAATCCTCAAGAATTGNGTCGGNGTAGNCAAGNCAGTACTAAGCGGTCT
CAGCTGGTAAAAACAGGATCTTTGTGGAAACATCTTTACCCTGTNCATTGGGCAAGAGGTG
Sequence Type mRNA
Unitrap ID UNI19604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 44156546..44162060 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039753 (Fbxl5) NM_178729 F-box and leucine-rich repeat protein 5 Gene [Source:MGI (curated);Acc:Fbxl5-002]

 
Come back to gene ENSMUSG00000039753


For any suggestions or comments, please send an email to unitrap@crg.es