Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST386081
Clone ID OST386081
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST386081
Sequence
TGTGTCAAAACCCAAAGCTGGCGCTCAAGCAACAGCCCGCCTTATATCTTAGACCTGCTGCCTGACACCTACCAGCACCT
CCGCACTGTCTTGTCAAGATATGAGGGGAAGATGGAGACGCTTGGAGAAAATGAGTATTTCAGGGTGTTCATGGAAAAAA
AAA
Sequence Type mRNA
Unitrap ID UNI2131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44009124..44009280 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]

 
Come back to gene ENSMUSG00000034342


For any suggestions or comments, please send an email to unitrap@crg.es