Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST386021
Clone ID OST386021
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST386021
Sequence
AGTTAACCATGGCATCCAGTGCCCAGAGAAAAAGGATGAGTCCTAAGCCTGAACTTACTGAAGACCAGAAACAGGAAATC
CGGGAAGCTTTTGATCTCTTTGATGCTGATGGAACTGGAACTATAGACATCAAAGAACTGAAGGTGGCAATGAGGGCCCT
GGGCTTTGAGCCCAAGAAAGAAGAAATTAAGAAAATGATAAGTGAAATTGATAAAGAAGGAACAGGAAAAATGAACTTCA
GTGACTTTTTGACAGTGATGACTCAGAAAATGTCTGAGAAAGACACTANAGAAGAAATCCTGAAAGCTTTCAAGTTGATC
GATGATGATGAGACTGGNAAAATATCATTNAAGAATCTTAAGCGCGNGGGNCAAGGAGNTGGGTNAGANCCTGANAGANG
AGGAACTGCAGTAAATGATTGATGANGCTNATNNNNGATGGAGATGTTGAGGNCATTGANCAAGAGATCCTGCCATCATG
Sequence Type mRNA
Unitrap ID UNI19618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70159564..70162165 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031347 (Cetn2) NM_019405 centrin 2 Gene [Source:MGI (curated);Acc:Cetn2-001]

 
Come back to gene ENSMUSG00000031347


For any suggestions or comments, please send an email to unitrap@crg.es