Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST385916
Clone ID OST385916
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST385916
Sequence
GACTGAGACTCCATCAGCAGCTACGAGNNCCCAGATCGCAGCCCTGAAACAGGAGCGGCAGCAGCAACAGCAGGACTTTG
AGGAGAAGGATCGAGAGCTGGGCCACCTCAAACAGCTGCTGGCCCGGGCCCACCCTTTGGACTCCTTGGAGAAGCAAATG
GAAAAGGTGGGGGTGGAACAACNGCCTGCCCTATNCNTGGGGTTTGAAATGATAGTGAGCGTTGTTGTCCCATAG
Sequence Type mRNA
Unitrap ID UNI14704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133579172..133579400 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030727 (Rabep2) NP_085043 rabaptin, RAB GTPase binding effector protein 2 Gene [Source:MGI (curated);Acc:Rabep2-001]

 
Come back to gene ENSMUSG00000030727


For any suggestions or comments, please send an email to unitrap@crg.es