Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0347
Clone ID XS0347
Vector pGT0lxf
Project sanger

Sequence tag XS0347
Sequence
CGCTACCTTTTTCTTTTCCTTTTCTGCACTGGTCCATAACTCACTATTCTTCCACGCACCTTGTTCACTGACATCTTTAC
CAGAGCTCCATCTACTCGTAGCCCCCTTACTTTTACTTCATTTAACCCCAGACACGCACGTCGTATTCGAACCTCGCCCC
AGAGCCCTTACCAAACCCAAGCGTCTCATGCAACATGGGATAAACTGGTATGCGCCGACATCTAACACGAAGGGAGATGA
TGATGAGGAATCTGATGAAGAAGCTGTGAAGAAAACTAACAAATGTGTACTAGTATGGGAG
Sequence Type mRNA
Unitrap ID UNI3744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95636484..95637759 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015748 (Prpf3) NM_027541 PRP3 pre-mRNA processing factor 3 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918017]

 
Come back to gene ENSMUSG00000015748


For any suggestions or comments, please send an email to unitrap@crg.es