Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST384454
Clone ID OST384454
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST384454
Sequence
TGGGCGAGCGCGCACCAGNATTTCACTGCGGNNCAGAGCACACGGCTCGCAANTGGGANGCACNGCCAGCNCCCACCAGC
TGCACCCCGCCTCCCCGGCCCCCTGTGTTGGAAGAGTGGACCTCAGTTGCCAAGCCTANGCTGGACCAAGCCTTGGTGGC
ANAGCACATTGAGAAGATGGTGGAGTCTG
Sequence Type mRNA
Unitrap ID UNI19660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6408452..6408570 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032946 (Rasgrp2) NM_011242 RAS, guanyl releasing protein 2 Gene [Source:MGI (curated);Acc:Rasgrp2-021]

 
Come back to gene ENSMUSG00000032946


For any suggestions or comments, please send an email to unitrap@crg.es