Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST383775
Clone ID OST383775
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST383775
Sequence
GAGCCGCACTCCATCCAGCAGACTTCTCTGTGTTCCACTGCCCCGACCATGCACCACCAGTCTGTTCTGCACAGCGGCTA
CTTTCACCCACTGCTTNGGAGCTGGCAGACTGCTGCCTCCACCGTNAGTGCCTCCAACCTCATCTATCCCATCTTNGTCA
CGGATGTTCCTGATGATGTCCAGCCTATCGCCAGCCTCCCAGGAGTGGCCAGGTATGGCGTNNACCAGCTAGAANAGACG
CTGNGACCTNTGGTGGNAGCTGGCCTGCGCTGTGTTCTGATCTTTGGCGTCCCCAGCANAGNTCCCAAGGATGAACAGGG
CTCTGCAGCCTGACTCTGAGGACTCCCCAACTATTGANGCTGTCCNTCNGCTGAGGAAGACCTTCCCTTCCCTACTATAT
GGCCTGTGACGTATGCTTGAGCCCNTACACCTTNTATGGCGCACTGTGGCCTTNTNAGTGAAAATGGAGCATTCCTAGCA
GAGGAGANCNGACNGCGNNCGGNANAGGNGGNACNGCCTTATGNCATAGAGCATCAGGGGCTCGCGCCAGCCGAAGGGA
Sequence Type mRNA
Unitrap ID UNI17423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62172742..62175269 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028393 (Alad) NM_008525 aminolevulinate, delta-, dehydratase Gene [Source:MGI (curated);Acc:Alad-001]

 
Come back to gene ENSMUSG00000028393


For any suggestions or comments, please send an email to unitrap@crg.es