Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0982
Clone ID GC0982
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC0982
Sequence
CTTCATCCTCACTTGACTTGCTGAGCTGCTTCACTAGATTTTGCTG
Sequence Type mRNA
Unitrap ID UNI359

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36061810..36061854 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es