Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST383592
Clone ID OST383592
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST383592
Sequence
GATCCGCTCACTGCATGAGCATGGGCCGATTGGAGCATACCTTCTGCACAGAGACCCGGCCCTACAACCAGGGAGCCCGG
CTGACTGGCCTTCGAGCTGGTGTACGAGCAGATCCCTGCAACTCTCATCACTGACAGCATGGCGGCGGCTGCCATGGCAC
ACCGGGGTGTGTCAGCCGTGGTGGTGGGAGCTGACCGTGTTGTTGCCAATGGAGACACAGCCAACAAAATAGGCACCTAT
CAGCTGGCCATTGTCGCCAAACACCACGGTGTCCCCTTCTATGTGGCTGCCCCCAGTTCATCCTGTGACCTCCATCTGGA
GACTGGAAAGGAGATTGTCATAGAGGAACGCCCCAGCCAGGAGCTAACTGACCTGAATGGAGTCAGGATTGCTGCACAGG
GAATCCGGGTTTGGAATCCTGCCTTTGATGTCACCCCCCACGAACTCATCACAGGTGGCATCATCACTGAACTGGGTGTC
TTTGCCCCTGAGGAGCTCC
Sequence Type mRNA
Unitrap ID UNI18056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86775512..86778247 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004996 (2410018C20Rik) NM_026423 RIKEN cDNA 2410018C20 gene Gene [Source:MGI Symbol;Acc:MGI:1915123]

 
Come back to gene ENSMUSG00000004996


For any suggestions or comments, please send an email to unitrap@crg.es