Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST383515
Clone ID OST383515
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST383515
Sequence
CTGGAAGCACAATGTCATCAGAATCCAGCAAAAAACGGAAACCCAAAGTGATCCGGAGTGATGGAACCCCAACTGAAGGG
AAACGGAACCGGTCTGACACGGAGCAGGAAGGCAAATACTACAGTGAGGAGGCTGAAGTTGACCTGCGGGACCCTGGCAG
AGACTATGAGTTGTACAAATACACTTGCCAGGAGCTACAAAGGCTGATGGCCGAGATCCAGGACCTGAAGAGTAAGGGCA
GCAAGGACCTGGCCATTGAAATTGAAGAACGAAGGATCCAGAGCTGTGTGCACTTCATGACTCTAAAGAAGCTTAACCGA
TTAGCCCACATCAGATTAAAGAAAGGAAGAGACCAGACCCACGAGGCCAAGCAGAAAGTCGATGCCTACCACCTACAGCT
ACAGAACCTGCTCTACGAAGTGATGCACCTGCAGAAGGAGATCACCAAATGTCTGGAGTTCAAGTCAAAGCATGAAGAAA
TTGATCTGGTCAGCTTTATTCAAT
Sequence Type mRNA
Unitrap ID UNI19691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4799803..4804130 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]

 
Come back to gene ENSMUSG00000034274


For any suggestions or comments, please send an email to unitrap@crg.es