Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST383152
Clone ID OST383152
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST383152
Sequence
TTCAAGTCCTAACACAGGCCACCAGCCAGGATACTGTTGTGANAGAAGCCAGCCGAGGAGCAACTGAAACAGTGGGAGAC
ACAGCCAGGTTTCTATTCAGNGTTGNTGAATATTTTTACGAATNACACCCTTGATATAAATGTACGGNGGCTTGCTGTGC
TGTATTTTAAACANGGGATTGATCGNTACTGGAGGCGTGTCGCACCGCATGCTCTCTCAGAAGAGGAAAAGTCAACATTG
C
Sequence Type mRNA
Unitrap ID UNI7597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107700865..107715199 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]

 
Come back to gene ENSMUSG00000042590


For any suggestions or comments, please send an email to unitrap@crg.es