Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST383093
Clone ID OST383093
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST383093
Sequence
GAGGTGGACAGTGGAATTCGGATGACCCCATCCCCAGAAAGGATCTGGAGCAAGGTGTGGTGGGGGCCCATGGCTTGCTC
TGCCGCCTCTCTGACCGTGTGGACAAGAAACTTCTGGATGCCGCAGGAGCCAACCTCAGAGTCATCAGCACCTTGTCTGT
GGGGGTCGACCACTTGGCTTTGGATGAAATCAAGAAGCGCGGGATCCGGGTGGGCTACACGCCAGGTGTCCTGACAGATG
CCACTGCAGAACTCGCCGTCTCCCTCCTCCTCACCACCTGCCGCCGGTTGCCGGAGGCCATAGAGGAAGTGAAGAACGGC
GGCTGGAGCTCCTGGAGCCCATTATGGATGTGCGGCTACGGACTCTCGCAGAGCACTGTTGGCATTGTGGGGCTGGGGCG
CATAGGTCAGGCCATCGCTCGACGACTGAAACCATTCGGTGTCCAGAGATTTCTTTACACGGGGCGCCAGCCCAGGCCTC
AGGAAGCAGCCGAGTTT
Sequence Type mRNA
Unitrap ID UNI19707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44995755..44999249 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035637 (Grhpr) NM_080289 glyoxylate reductase/hydroxypyruvate reductase Gene [Source:MGI (curated);Acc:Grhpr-001]

 
Come back to gene ENSMUSG00000035637


For any suggestions or comments, please send an email to unitrap@crg.es