Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST382772
Clone ID OST382772
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST382772
Sequence
ATTTTGTGGTATCCAGCNTCAGGCCTTTGAGTTGGGAGATACAAAGTCCTCCGAAAAAAGACCGGTGCCTCGGATGAGCC
CCCTCACAGAGAGATGAAGGGGCAGCAGAAAACAGCTGAAACCGAAGAGGGAACAGTGCAGATTCAGGAAGGCGCAGTGG
CTACTGGAGAGGACCCAACTAGTGTAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCCCAACGTCAAGTAC
GTTTTCCGAACTGACAATGGGGGCCAGGTGATGTACA
Sequence Type mRNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173344578..173345963 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es