Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST382618
Clone ID OST382618
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST382618
Sequence
GAGCAGTTTGTATTCTACTACCACATGGACCCCTTCAGGCCCATGAGCGGACGGTTCAAAGACCGGGTGGTCTGGGACGG
AAACCCCGAGCGATATGACGTCTCCATCTTGCTCTGGAAGCTGCAGTTTGACGACAATGGGACATACACCTGCCAGGTGA
AGAATCCACCTGATGTTGATGGTCTGGTTGGGACGATCCGGCTCAGCGTTGTGCACACTGTGCCCTTNTCTGANATCTAC
TNCCTGGCCGAGGCCATTTGGCTCTGCGCNCGCACTGATGATTATCGTA
Sequence Type mRNA
Unitrap ID UNI19732

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44852236..44855314 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032092 (Mpzl2) NM_007962 myelin protein zero-like 2 Gene [Source:MGI (curated);Acc:Mpzl2-001]

 
Come back to gene ENSMUSG00000032092


For any suggestions or comments, please send an email to unitrap@crg.es