Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0987
Clone ID GC0987
Cell line E14Tg2A.4
Vector pFLIP2
Project tigem
Note NULL

Sequence tag GC0987
Sequence
CCGGTTCCAGGCATTCGGGNATTTGAATGTAGTAATGCTTTTTTTTTTTTCGCTTTTATTTTTCAAAAACCCACTTAAAA
AAAAAAAAAAAAAAATTTGACCCCGGGCTTTTTGACCCGCCGCTGATGACGGCCATGGTGGAGCTCATCACCGAGGACTA
CGCCCACTTTGTCAACCTCTCAACAAACCTGGTTGGCATGGACAGAGCCCTCAACCAACTTTCTGTGCCTTTGGGACAGT
TACGAGAAGAGGTTCTGAGTCTTAGGTCCTCTGTCAGTGAAGGAATTCTGGCAGTAGATGAACGAATGTCTAAGCAAGAA
GACATTAGGAAAAAAAAAAAAAAAAAAATTTGGCCCCGGGTTTTAAACCCCCGGGTTATAATAAATGATTTCCTTCGTAA
TTTGTCCATACGTTTTCCCTAAAAAAAAGATTCGCGCTGGTTTTTTGTGCCTTCTCCTATTGTGGGTGGTAGTAGGCTGG
TTTTTCTCACTTCCATAGCGAGTATCACGTCCTATGGTT
Sequence Type mRNA
Unitrap ID UNI361

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127049600..127052955 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031979 (Cog2) NM_029746 component of oligomeric golgi complex 2 Gene [Source:MGI (curated);Acc:Cog2-001]

 
Come back to gene ENSMUSG00000031979


For any suggestions or comments, please send an email to unitrap@crg.es