Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XQ0382
Clone ID XQ0382
Vector pGT0lxf
Project sanger

Sequence tag XQ0382
Sequence
GGACGCACAGGTAGAGCTTGCTGGACAGGAATTTGTGTATGTTTTTATCAACCAAGGGAAAGAGGTCAANTGTGATATGT
GGAGCAGAAAGCTGGAATTATTTTTAAACGTGTAGGTGTTCCGTCTACAATGGATTTAGTTAAATCTAAAAGCATGGATG
CCATCAGGTCTCTGGCTTCTGTTTCTTATGCTGCTGTTGATTTTTTCCGACCATCAGCTCAAAGACTGATAGAAGAGAAG
GGGGCAGTGGATGCATTGGCTGCAGCATTAGCTCACATTTCTGGTGCATCAAGCTTTGAACCACGATCTTTGATAACTTC
TGATAAGGGGTTTGTGACCATGACTCTGGAGAGCCCAGAAGAAATACAGGATGTCAGCTGCGCTTGGAAGGAACTTAACA
GAAAGCTCAGTAGTAATGCTGTGTCTCACGTAACCAGAATGTGCCTCCTGAAAGGAAATATGGGTGTTTGCTTTGATGTT
Sequence Type mRNA
Unitrap ID UNI3772

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62082360..62089003 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020076 (Ddx50) NM_053183 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 Gene [Source:MGI Symbol;Acc:MGI:2182303]

 
Come back to gene ENSMUSG00000020076


For any suggestions or comments, please send an email to unitrap@crg.es