Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST382347
Clone ID OST382347
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST382347
Sequence
ACCAGAGCTCAAGCTNCTGGAAGCCTTTCCCAGCACCCTGGGTTCAAAGCCAGAAAGCCAAGCTACATTCTCCTCCCAGT
TGGCACCAGTTGACAACGCCTTGGGTGTGGGTTTNTTGTAAAGAACATAGAGAACAATCAGCCGGCAATTATGGGAGGAG
GAAGGGGGGGC
Sequence Type mRNA
Unitrap ID UNI19739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21573086..21573255 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es