Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST382303
Clone ID OST382303
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST382303
Sequence
ACTGAGCAGCGTTCATCTTCCCGAATTGGACATGCTACAAAGGGTTTTAACTGGTATGGTACCGAACGACTTATCCGGAA
ACATTTGGCTACACGAGGCATCCCAACTTACATATACTACTTTCCCAGAAGTAAGGCCCGCCATTCACAGCCTGCATCCT
CCTCCTCAGCACCACTGGTTCCCTAGCAACCAGCCCAGCATTGGGTCCAGTTTTCAGCAACCAGTTAGATTCTTGCTCCC
AGATTGACTGTTAGTTTTCAGGAAACAAGGCTATCTTTGGTCATATTCTCTGCTCTGGAATTTCTGGGCTAGTCTTTCCT
GAATTCTAATTTTGTTGCTCTGGAAGTGTTAACTGTGATCCAGTACCTGTAATACAGGAACACACAATGTATATGGGGAA
GCCCTTTGGCTTCAGATTGCCTATGTTTGAATAATAATAATAATAGATGGCCTATTGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 97364663..97366608 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028089 (Chd1l) NM_026539 chromodomain helicase DNA binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1915308]

 
Come back to gene ENSMUSG00000028089


For any suggestions or comments, please send an email to unitrap@crg.es