Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST382252
Clone ID OST382252
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST382252
Sequence
ACTGAGGACCCAGAGGCCGCAGATGTGATATTTGCCACCATCCGTGAATTGGTGTCACGGGGGCGGAGTGTCCACTTTTC
TGAGGCTGAACAGCGCTGCATATCTCGTGGCTTCACACCAGCCCAGTTCCAGGCAGCCTCTGGATGAATATGAGGAGCTA
NATGTCTGGCAGGTTAATACTTCTCGGACACGGATCACCTTTGTCTGATAGCCAGTTTTTACACCCTCCTGCCTACACCA
GAGGGCATGCGTGAATGCCCCCTCAAGAAAAAATCTCATTCTCCCATGCTGCACTTTTTTATTCTGCCAATAAAGTGTTT
TGATTGCC
Sequence Type mRNA
Unitrap ID UNI17866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138605828..138606150 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029730 (Mcm7) NM_008568 minichromosome maintenance deficient 7 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1298398]

 
Come back to gene ENSMUSG00000029730


For any suggestions or comments, please send an email to unitrap@crg.es