Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST382003
Clone ID OST382003
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST382003
Sequence
TGAGCCAGGCATCTTACGTCTTCCTAAGCATGGCAAGGGGACTTCATGAAGCCTGCCATCGACGTTGTGGATAAGTTGCT
GGCAGCTGGGGTCAATGTGACCGTGTACAACGGACAGCTGGATCTCATTGTGGACACCATAGGTCAGGAGTCCTGGGTTC
AGAAGCTCAAGTGGCCACAGCTGTCCAAATTCAATCAGCTAAAATGGAAGGCCCTGTACACCGATCCCAAGTCTTCAGAA
ACAGCTGCGTTCGTCAAGTCCTATGAGAACCTAGCCTTCTACTGGATCCTAAAGGCCGGTCACATGGTTCCTTCTGACCA
AGGGGAGATGGCCCTGAAGATGATGAAGCTGGTGACCAAGCAGGAGTAGCTGAGCTGGCTGGCCCTGGAGGCGCTAAGAG
CAGAGCCCAGGATGCAGGTGCTAATGTCTATNCCTGGTGCTCTTCTCCCCCGCTCTGCCATGGGATATGACTCTGGGAGC
ACCTGCTNTCTCCCGTACCAAAAAGACTGTGGCCCTTCTGTGGTCTACTTTAGAAA
Sequence Type mRNA
Unitrap ID UNI10315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88785813..88791658 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es