Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST381918
Clone ID OST381918
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST381918
Sequence
ACTGAGAGACGGAAGGCTCCCTTATGGACTTAAGACAGTCAAGGCAGTGCACGTCCCTGGGAGGTCGTCCATGTCCCGAG
AAGAGCAGCCGATTCCTGGATTGCGAGAGTCCTGTGCACGTATTTATGAGCCTGTCCCCACCGAAAGCAGTAATCCTTCA
GGCCAAGCCATCCAATTTTAAACCCCGCTGCCTTGTTCATGTTGGGTATACAGAGACTCAGAGGCGCTAGTTAATGGCCA
GCCTGACCTGTCTTCCTTGTGTTTCGGGGGGTGAAAGGAGGTTCCAGGAGAATAATGCCCTGGAATATTCTGAGGCTGAA
ATGTTGTGTCTCGGATAGACAGAGTACTTCTCCGTGGGTCCTCCTGCACAGAAGCCCCCTTCTGCTCTGTTGTCAATCAC
TGGGTTAGTTTTTTGTTTTGTTTTGTTTCTGTTGTTCTCTTCTTTCTGGGTTGATCTTAATCTTTGGAAATACACAGTGC
TGCTCAGGTTTGCCTGGTTCCCCTGTGTGACCTTCCCCCCCACACACACACAAAGTTAC
Sequence Type mRNA
Unitrap ID UNI16783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106515944..106516480 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es