Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0336
Clone ID XP0336
Vector pGT0lxf
Project sanger

Sequence tag XP0336
Sequence
GATCAACCCGGCACTTGCCAACATGGAAGGTGGAGACAGCACAATTTCCGTAGCAGGCCGTGGGGCTTCGGGTTCCGCAG
TAGTGGCGGCGACCGTGCAGGCGATCCTGCAGGACGACTGTTATAGTGAATTTTTAAATGAAGACTTTGATGTAAAAACT
TACACTTCCCAATCTATTCATCAAGCTGTAATTGCTGAGCAACTAGCAAAACTTGCCCAAGGGATCAGTCAGCTGGATAA
AGAACTACACCTACAGGTTGTTGCAAGACATGAAGATTTACTGGCACAAGCAACTGGGATTGAGTCTTTGGAAGGTGTTC
TTCAGATGATGCAGACGAGAATTGGAGCTCTACAGGGAGCTGTTGATAGGATGAAATCAAAGATTGTTGAACCATACAAT
AAAATAGTAGCCCGTACTGCACAACTGGCAAGACTTCAG
Sequence Type mRNA
Unitrap ID UNI3786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32339734..32355250 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es