Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0317
Clone ID XP0317
Vector pGT0lxf
Project sanger

Sequence tag XP0317
Sequence
AACAGAGACGAGGCGTTACACTAACCACNCCCTGTCNTACGATCAGGCAAAACGGGTGCCCAGAAGGGTTCTNGAGCATA
TATCCAAGGACAAGATCATCGGTGACGCTGACAGAAAGCATNGTAAATTCAAGCCGGATCCTTCTGTCCCTTCAGCCTTC
AGCGCCCTCAATGAAGACTATATCGGGAGTGGCTGGTCACGAGGCCACATGGCCCCGGCAGGAAATAACAAGTTTTCCAG
TGAAGCCATGGCAGAAACCTTTTACCTTTCTAATATCGTGCCTCAGAATTTTGATAATAACTCCGGCTACTGGAACAGAA
TAGAAATGTATTGTCGTGAGCTGACGGAGAGATTTGAAGATGTTTGGATAGTATCAGGACCTTTAACCTTACCTCATACT
AGGAATGATGGAACGAAAACAGTTAGTTACCAG
Sequence Type mRNA
Unitrap ID UNI3788

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119356116..119361460 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042787 (Endogl1) NM_172456 endonuclease G-like 1 Gene [Source:MGI Symbol;Acc:MGI:2143333]

 
Come back to gene ENSMUSG00000042787


For any suggestions or comments, please send an email to unitrap@crg.es