Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST380962
Clone ID OST380962
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST380962
Sequence
TGAGGAGCTCTTACCAAAGTAAAGGAGAGTAGGCGACACGTGGAAGAAGGGAAGATGGAGGTCCAAAAAGCTGACGGCAT
TCAAGACCGCTGTAACACTATTTCCTTCGCCACGTTGGCCGAGATTCATCACTTCCATCAAATTAGAGTAAGAGACTTTA
AATCACAGATGCAACATTTTTTACAACAACAAATAATATTTTTCCAAAAAGTGACCCAGAAGTTGGAAGAGGCGCTTCAC
AAATACGACAGCGTCTAATGACTGCACATGGGACCGCGCTCTTGTTTTCAGTTGAACGATAATTTCCACAGCAGAACAAA
ACCTGCCTTCTCAGAGCTGTTGCCAACTCTAGGTGGTACAAGGACGGCTTTGTGTTCAGCCGAAACCGGCTGGATATATA
ATTATGTAGGAAAGAAGCAGTTAATATGGCTATGTAGCANAAACAGTACCACACTTTGTAACTAAATTATACTATGTATG
CCTACACTA
Sequence Type mRNA
Unitrap ID UNI11791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114384586..114385072 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042364 (Snx18) NM_130796 sorting nexin 18 Gene [Source:MGI Symbol;Acc:MGI:2137642]

 
Come back to gene ENSMUSG00000042364


For any suggestions or comments, please send an email to unitrap@crg.es