Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST380936
Clone ID OST380936
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST380936
Sequence
AATAAGGTAACTGACCTGTGCCTGTCCTTCTTCAAACGCTGTGGAAATATCTGTCATATTGACCTGAGGTACTGCAAGCA
AGTCACCAAGGAAGGCTGTGAGCAATTCATAGCTGAAATGTCTGTGAGTGTCCAATTTGGGCAAGTGGAAGAGAAACTCC
TGCAAAAACTAAGTTAGTTCCAGGACAAGTATGTAAATATGGAGGGTTGGGGGGAATACAACCAGG
Sequence Type mRNA
Unitrap ID UNI12912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123321676..123321901 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40859725..40859950 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078482 (AL837521.6)  

 
Come back to gene ENSMUSG00000078482


For any suggestions or comments, please send an email to unitrap@crg.es