Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST380902
Clone ID OST380902
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST380902
Sequence
GAATTTGATGTCTCTGGACTAACTGACACTGATATTAGACCGAANTTCAATTTAAAACCAAACACAAAAGGAATTACTCT
ACAGTCAATAACAGGCAGTCAGCGTTTAGATGTAGAAGAGTTCCAGAATGATGAAGAAGACTTGAGTCCACCTGTGATGG
AATATAATATCGATGTGAAATCAAACACTGAGATACAGTTAGCAGAGATAAATAAAGATGTAGCCTCGATACCTAGTGAA
TCTTCAACAGAATCTGTTAAAGATCTTCAGGAGGTCAAAAGTAAGACACA
Sequence Type mRNA
Unitrap ID UNI19776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48948511..48953910 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064061 (Dzip3) NM_027341 DAZ interacting protein 3, zinc finger Gene [Source:MGI (curated);Acc:Dzip3-001]

 
Come back to gene ENSMUSG00000064061


For any suggestions or comments, please send an email to unitrap@crg.es